Chapter 6 Molecular Basis of Inheritance (वंशागति का आणविक आधार)

अभ्यास के अन्तर्गत दिए गए प्रश्नोत्तर

प्रश्न 1.
निम्न को नाइट्रोजनीकृत क्षार व न्यूक्लिओटाइड के रूप में वर्गीकृत कीजिए-एडेनीन, साइटीडीन, थाइमीन, ग्वानोसीन, यूरेसील व साइटोसीन।
उत्तर
नाइट्रोजनीकृत क्षार – एडेनीन, थाइमीन, यूरेसील, साइटोसीन।
न्यूक्लिओटाइड – साइटीडीन, ग्वानोसीन।

प्रश्न 2.
यदि एक द्विरज्जुक DNA में 20 प्रतिशत साइटोसीन है तो DNA में मिलने वाले एडेनीन के प्रतिशत की गणना कीजिए।
उत्तर
चारग्राफ के नियमानुसार द्विरज्जुक DNA में →A + G = T + C = 1 होता है। अर्थात् एडेनीन = थाइमीन,
ग्वानिन = साइटोसीन
चूँकि साइटोसीन की दी गई मात्रा 20% है तो ग्वानिन भी 20% होगा।
ग्वानिन + साइटोसीन = 20 + 20 = 40%
A + G = 100 – 40%
A + G = 60%
चूँकि A = G होता है; अत: एडेनीन की मात्रा = 60/2 = 30% होगी।

प्रश्न 3.
यदि डी०एन०ए० के एकरज्जुक के अनुक्रम निम्नवत् लिखे हैं –
5′ – ATGCATGCATGCATGCATGCATGCATGC – 3′
तो पूरक रज्जुक के अनुक्रम को 5 → 3 दिशा में लिखिए।
उत्तर
डी०एन०ए० द्विकुण्डली संरचना होती है अर्थात् यह दो पॉलिन्यूक्लियोटाइड श्रृंखलाओं (polynucleotide chains) से बना होता है। दोनों श्रृंखलाएँ प्रतिसमानान्तर ध्रुवणता रखती हैं। इसका तात्पर्य है यदि एक श्रृंखला की ध्रुवणता 5 से 3′ की ओर हो तो दूसरे की ध्रुवणता 3 से 5′ की तरफ होगी।

दोनों श्रृंखलाओं के नाइट्रोजनी क्षार परस्पर हाइड्रोजन बन्ध (bonds) द्वारा जुड़े रहते हैं। ऐडेनीन दो हाइड्रोजन बन्ध द्वारा थाइमीन (A = T) से और साइटोसीन तीन हाइड्रोजन बन्ध द्वारा ग्वानीन (C ≡ G) से जुड़े होते हैं। इसके फलस्वरूप प्यूरीन (purine) के विपरीत दिशा में पिरिमिडीन (pyrimidine) होता है। इससे डी०एन०ए० द्विकुण्डली के दोनों पॉलिन्यूक्लियोटाइड के मध्य समान दूरी बनी रहती है। अतः डी०एन०ए० के पूरक रज्जुक (श्रृंखला) में नाइट्रोजनीकृत क्षार का अनुक्रम निम्नवत् होगा –
5′ – ATGCATGCATGCATGCATGCATGCATGC-3′
3′ – TACGTACGTACGTACGTACGTACGTACG-5′

प्रश्न 4.
यदि अनुलेखन इकाई में कूट लेखन रज्जुक के अनुक्रम को निम्नवत् लिखा गया है –
5′ – ATGCATGCATGCATGCATGCATGCATGC – 3′
तो दूत-आर०एन०ए० के अनुक्रम को लिखिए।
उत्तर
आर०एन०ए० का निर्माण डी०एन०ए० से होता है। आर०एन०ए० सामान्यतया एकरज्जुकी संरचना (single strand structure) होती है। इसमें थाइमीन नाइट्रोजनीकृत क्षार के स्थान पर यूरेसिल (uracil) पाया जाता है। डी०एन०ए० का एकरज्जुक (अनुलेखन इकाई) से आनुवंशिक सूचनाओं का दूत-आर०एन०ए० (m-R.N.A.) में प्रतिलिपिकरण करने की प्रक्रिया अनुलेखन (transcription) कहलाती है।
यदि कूटलेखन रज्जुक (coding strand) के अनुक्रम निम्नवत् हैं –
5′ – ATGCATGCATGCATGCATGCATGCATGC – 3’।
तो दूत-आर०एन०ए० (m-R.N.A.) के अनुक्रम निम्नवत् होंगे –
5′ – AUGCAUGCAUGCAUGCAUGCAUGCAUGC – 3′

प्रश्न 5.
DNA ढिकुंडली की कौन-सी विशेषता ने वाटसन व क्रिक को DNA प्रतिकृति के सेमी कंजर्वेटिव रूप को कल्पित करने में सहयोग किया? इसकी व्याख्या कीजिए।
उत्तर
वाटसन व क्रिक ने DNA का द्विकुंडली मॉडल दिया था। इस मॉडल की मुख्य विशेषता पॉलीन्यूक्लिओटाइड श्रृंखलाओं के बीच युग्मन का होना था। पॉलीन्यूक्लिओटाइड श्रृंखलाओं में क्षार युग्मन ही एक ऐसी विशेषता थी जिसने वाटसन व क्रिक को DNA प्रतिकृति के सेमी कंजर्वेटिव रूप को कल्पित करने में सहयोग किया था। क्षार-युग्मन के इसी गुण के आधार पर श्रृंखलाएँ एक-दूसरे की पूरक बनती हैं अर्थात् एक DNA रज्जुक में क्षार अनुक्रम पता होने पर दूसरे रज्जुक के क्षार युग्मन को ज्ञात किया जा सकता है।

इसके अतिरिक्त DNA का प्रत्येक रज्जुक, नये DNA रज्जुक के संश्लेषण हेतु साँचे का कार्य करता है। इस साँचे से बना द्विकुंडलित DNA अपने जनक DNA के समरूप होता है। DNA प्रतिकृतिकरण की सेमी कंजर्वेटिव पद्धति में DNA के दोनों रज्जुक पृथक् होकर नये रज्जुक के संश्लेषण हेतु साँचे के समान कार्य करते हैं। DNA प्रतिकृति में एक जनक रज्जुक व एक नया रज्जुक होता है।

प्रश्न 6.
टेम्पलेट (डी०एन०ए० या आर०एन०ए०) की रासायनिक प्रकृति व इससे (डी०एन०ए० या आर०एन०ए०) संश्लेषित न्यूक्लीक अम्लों की प्रकृति के आधार पर न्यूक्लीक अम्ल पॉलिमरेज के विभिन्न प्रकार की सूची बनाइए।
उत्तर
न्यूक्लीक अम्ल पॉलिमरेज निम्नलिखित प्रकार के होते हैं –
1. डी०एन०ए० पॉलिमरेज (D.N.A. polymerase) एन्जाइम प्रतिकृति (replication) के लिए आवश्यक है। यह डी०एन०ए० टेम्पलेट का उपयोग डि-ऑक्सीन्यूक्लियोटाइड के बहुलकन (polymerisation) को प्रेरित करने के लिए करता है। डी०एन०ए० अणुओं की दोनों श्रृंखलाएँ एकसाथ पृथक् नहीं होतीं। डी०एन०ए० द्विकुण्डली प्रतिकृति हेतु छोटे-छोटे भागों में खुलती है। इसके फलस्वरूप बनने वाले खण्ड परस्पर डी०एन०ए० लाइगेज (D.N.A. ligase) एन्जाइम द्वारा जुड़ जाते हैं। डी०एन०ए० पॉलिमरेज स्वयं प्रतिकृति प्रक्रम का प्रारम्भ नहीं कर सकते। यह कुछ निश्चित स्थल पर संवाहक (vector) की सहायता से होती है।

2. आर०एन०ए० पॉलिमरेज (R.N.A. polymerase) – यह डी०एन०ए० पर निर्भर आर०एन०ए० पॉलिमरेज (D.N.A. dependent R.N.A. polymerase) होता है। यह D.N.A. को सभी प्रकार के आर०एन०ए० के अनुलेखन (transcription) के लिए उत्प्रेरित करता है। आर०एन०ए० पॉलिमरेजे अस्थायी रूप से प्रारम्भन कारक या समापन कारक से जुड़कर अनुलेखन का प्रारम्भ या समापन करता है। केन्द्रक में डी०एन०ए० पर निर्भर आर०एन०ए० पॉलिमरेज के अतिरिक्त निम्नलिखित तीन प्रकार के आर०एन०ए० पॉलिमरेज मिलते हैं –

  1. आर०एन०ए० पॉलिमरेज I – यह राइबोसोमल आर०एन०ए० (r-R.N.A.) को अनुलेखित (transcribes) करता है।
  2. आर०एन०ए० पॉलिमरेज III – यह ट्रान्सफर आर०एन०ए० (t-R.N.A.) तथा छोटे केन्द्रकीय आर०एन०ए० के अनुलेखन के लिए उत्तरदायी होता है।
  3. आर०एन०ए० पॉलिमरेज II – यह सन्देशवाहक आर०एन०ए० (m-R.N.A.) के पूर्ववर्ती विषमांगी केन्द्रकीय आर०एन०ए० (heterogenous nuclear R.N.A.-hnR.N.A.) का अनुलेखन करता है।

प्रश्न 7.
DNA आनुवंशिक पदार्थ है, इसे सिद्ध करने हेतु अपने प्रयोग के दौरान हर्णे व चेज ने DNA व प्रोटीन के बीच कैसे अंतर स्थापित किया?
उत्तर
हशें वे चेज ने DNA को आनुवंशिक पदार्थ सिद्ध करने हेतु P32 व P32 आइसोटॉप्स युक्त माध्यम, में ई० कोलाई जीवाणु का संवर्द्धन कराया। कुछ समय वृद्धि करने के पश्चात् जीवाणु को जीवाणुभोजी द्वारा संक्रमित कराया गया। संक्रमण के पश्चात् देखा गया कि जीवाणुभोजी का प्रोटीन आवरण S35 रेडियोधर्मी युक्त हो गया था जबकि इसके DNA में सल्फर नहीं होता। इसके विपरीत जीवाणुभोजी का DNA P32 रेडियोधर्मी आइसोटॉप्स की उपस्थिति दिखा रहा था, क्योंकि DNA में

UP Board Solutions for Class 12 Biology Chapter 6 Molecular Basis of Inheritance Q.7

फॉस्फोरस होता है। प्रोटीन आवरण में P32 अनुपस्थित था। P32 रेडियोधर्मी युक्त जीवाणुभोजी द्वारा ऐसे जीवाणु को संक्रमित कराया गया जिसमें रेडियोधर्मी तत्त्व नहीं थे। संक्रमण के पश्चात् देखा गया कि समस्त जीवाणु रेडियोधर्मी हो गये थे। अधिकांश रेडियोधर्मी आइसोटॉप्स जीवाणुभोजी की अगली पीढ़ी में भी स्थानांतरित हो गये थे।

रेडियोधर्मी तत्त्व रहित जीवाणुओं में S32 युक्त जीवाणुभोजी द्वारा संक्रमण कराने पर तथा जीवाणुभोजी पृथक् करने पर देखा गया कि जीवाणुओं में रेडियोधर्मी तत्त्व मौजूद नहीं थे बल्कि ये जीवाणुभोजी के प्रोटीन आवरण में ही रह गये थे। उपरोक्त प्रयोग सिद्ध करता है कि जीवाणुभोजी का DNA ही वह पदार्थ है जो नये जीवाणुभोजी उत्पन्न करता है व संक्रमण में भाग लेता है। यह सिद्ध हो गया कि DNA आनुवंशिक पदार्थ है, प्रोटीन नहीं। इसके अतिरिक्त DNA फॉस्फोरस युक्त होता है जबकि प्रोटीन में फॉस्फोरस नहीं होता है। DNA सल्फर रहित होता है, जबकि प्रोटीन, सल्फर युक्त होता है।

प्रश्न 8.
निम्न के बीच अंतर बताइए –
(क) पुनरावृत्ति DNA एवं अनुषंगी DNA
(ख) mRNA और tRNA
(ग) टेम्पलेट रज्जु और कोडिंग रज्जु
उत्तर
(क) पुनरावृत्ति DNA एवं अनुषंगी DNA में अंतर
UP Board Solutions for Class 12 Biology Chapter 6 Molecular Basis of Inheritance Q.8.1

(ख) एमआरएनए और टीआरएनए में अंतर
UP Board Solutions for Class 12 Biology Chapter 6 Molecular Basis of Inheritance Q.8.2

(ग) टेम्पलेट रज्जु और कोडिंग रज्जु में अंतर
UP Board Solutions for Class 12 Biology Chapter 6 Molecular Basis of Inheritance Q.8.3

प्रश्न 9.
स्थानान्तरण के दौरान राइबोसोम की दो मुख्य भूमिकाओं की सूची बनाइए।
उत्तर
स्थानान्तरण (Translation) – इस प्रक्रिया में ऐमीनो अम्लों के बहुलकन (polymerisation) से पॉलिपेप्टाइड का निर्माण होता है। ऐमीनो अम्लों के क्रम व अनुक्रम सन्देशवाहक आर०एन०ए० में पाए जाने वाले क्षारों के अनुक्रम पर निर्भर करते हैं। ऐमीनो अम्ल पेप्टाइड बन्ध (peptide bonds) द्वारा जुड़े रहते हैं। स्थानान्तरण प्रक्रिया पूर्ण होने पर पॉलिपेप्टाइड श्रृंखला राइबोसोम से पृथक् हो जाती है।
UP Board Solutions for Class 12 Biology Chapter 6 Molecular Basis of Inheritance Q.9

स्थानान्तरण में राइबोसोम की भूमिका
1. राइबोसोम का छोटा सबयूनिट m-R.N.A. के प्रथम कोडॉन (AUG) के साथ बन्धित होकर समारम्भ कॉम्प्लैक्स (initiation complex) ऐमीनो ऐसिल t-R.N.A. बनाता है जिसकी पहचान प्रारम्भक t-R.N.A. द्वारा की जाती है। ऐमीनो अम्ल t-R.N.A. से जुड़कर एक जटिल रचना बनाते हैं जो आगे चलकर t-R.N.A. के प्रति प्रकूट (anticodon) से पूरक क्षार युग्म बनाकर m-R.N.A. के उचित आनुवंशिक कोडॉन से जुड़ जाती है।

2. राइबोसोम के बड़े सबयूनिट पर t-R.N.A. अणुओं के जुड़ने के लिए दो खाँच होती हैं, इन्हें P-site या दाता स्थल और A-site या ग्राही स्थल कहते हैं। P-site (दाता-स्थल) पर पॉलिपेप्टाइड श्रृंखला को धारण करने वाला t-R.N.A. जुड़ता है। A-site (ग्राही स्थल) पर ऐमीनो ऐसिल t-R.N.A. जुड़ता है। बड़े सबयूनिट के पेप्टाइड सिन्थेटेज (peptide synthetase) एन्जाइम पॉलिपेप्टाइड श्रृंखला के ऐमीनो अम्ल के -COOH तथा ऐमीनो ऐसिल t-R.N.A. के ऐमीनो अम्ल के – NH, के मध्य पेप्टाइड बन्ध बनाता है।

प्रश्न 10.
उस संवर्धन में जहाँ ई० कोलाई वृद्धि कर रहा हो लैक्टोस डालने पर लैक-ओपेरॉन उत्प्रेरित होता है, तब कभी संवर्धन में लैक्टोस डालने पर लैक-ओपेरॉन कार्य करना क्यों बन्द कर देता है?
उत्तर
ओपेरॉन संकल्पना
मनुष्य की आँत में पाए जाने वाले जीवाणु ई० कोलाई सामान्यतया लैक्टोस के अपचय से ऊर्जा प्राप्त करते हैं। जैकब एवं मोनोड (Jacob & Monod, 1961) ने पता लगाया कि इसके D.N.A. में तीन जीन का एक समूह लैक्टोस का अपचय करने वाले तीन एन्जाइम्स के संश्लेषण से सम्बन्धित होता है। पोषण माध्यम में लैक्टोस होता है तो ये जीन सक्रिय होते हैं। पोषण माध्यम में लैक्टोस के अभाव में ये निष्क्रिय रहते हैं। जैकब एवं मोनोड ने इस जीन की सक्रियता के नियमन के लिए ओपेरॉन संकल्पना (operon concept) प्रस्तुत की।

ओपेरॉन संकल्पना के अनुसार जीन की सक्रियता का नियमन अनुलेखन स्तर पर प्रेरण या दमन (induction or repression) द्वारा होता है। लैक्टोस का अपचय करने वाले एन्जाइम्स β –गैलेक्टोसाइडेज (β-galactosidase), गैलेक्टोस परमीएज (galactose permease) तथा थायोगैलेक्टोसाइडेज ट्रान्सऐसीटिलेज (thiogalactosidase transacetylase) हैं। इनके संरचनात्मक जीन्स (structural genes) को क्रमशः सिस्ट्रॉन-z, सिस्ट्रॉन-y तथा सिस्ट्रॉन-a द्वारा प्रदर्शित करते हैं। ये एक-दूसरे के निकट स्थित होते हैं। इनमें परस्पर समन्वय होता है।

तीन जीन इनको कन्ट्रोल करते हैं, इन्हें रेगुलेटर जीन (regulator gene), प्रोमोटर जीन (promoter gene) तथा ओपरेटर जीन (operator gene) कहते हैं। किसी उपापचयी तन्त्र में एन्जाइम्स को कोड करने वाले जीन सामान्यतया समूह (cluster) के रूप में गुणसूत्र पर स्थित होती हैं। ये एक कार्यक जटिल (functional complex) बनाती हैं। इस पूरे तन्त्र को लैक ओपेरॉन कहते हैं। इसमें संरचनात्मक जीन (structural genes), प्रोमोटर जीन (promoter gene), ओपरेटर जीन (operator gene) तथा रेगुलेटर जीन (regulater gene) आदि मिलती हैं।

लैक ओपेरॉन = रेगुलेटर जीन + प्रोमोटर जीन + ओपेरेटर जीन + संरचनात्मक जीन लैक ओपेरॉन का प्रकार्य
(A) लैक्टोस की अनुपस्थिति में (In absence of Lactose) – लैक्टोस प्रेरक की अनुपस्थिति में
रेगुलेटर जीन एक लैक निरोधक या दमनकारी प्रोटीन बनाता है। यह ओपरेटर जीन से बन्धित होकर इसके अनुलेखन को रोकता है। इसके फलस्वरूप संरचनात्मक जीन m-R.N.A.

UP Board Solutions for Class 12 Biology Chapter 6 Molecular Basis of Inheritance Q.10
UP Board Solutions for Class 12 Biology Chapter 6 Molecular Basis of Inheritance Q.10
का संश्लेषण नहीं कर पाते और प्रोटीन संश्लेषण रुक जाता है। यह दमनकर (repression) का उदाहरण है।

(B) लैक्टोस की उपस्थिति में (In presence of Lactose) – माध्यम में लैक्टोस प्रेरक के उपस्थित होने पर प्रोमोटर कोशिका में प्रवेश करके रेगुलेटर जीन से उत्पन्न दमनकर से बन्धित होकर जटिल यौगिक बनाता है। इसके कारण दमनकर ओपरेटर से बन्धित नहीं हो पाता। और ओपरेटर स्वतन्त्र रहता है। यह R.N.A.-पॉलिमरेज को प्रोमोटर जीन के समारम्भन स्थल से बन्धित होने के लिए प्रेरित करता है जिसके फलस्वरूप पॉलिसिस्ट्रोनिक लैक m-R.N.A. का अनुलेखन होता है। यह लैक्टोस अपचय के लिए आवश्यक तीनों एन्जाइम्स को कोडित करता है। इस क्रिया को एन्जाइम उत्प्रेरण कहते हैं। यह उत्प्रेरण या प्रेरण (induction) का उदाहरण है। इसमें लैक्टोस उत्प्रेरक का कार्य करता है।

(C) सहदमनकर (Co-repressor) – कभी-कभी मेटाबोलाइट (लैक्टोस) से बन्धित होने पर निरोधक या दमनकर की संरचना में परिवर्तन हो जाता है। यह ओपरेटर से बन्धित होकर इसके अनुलेखन (transcription) को रोकता है। इसमें मेटाबोलाइट (लैक्टोस) को सहदमनकर कहते हैं, क्योंकि यह ओपरेटर स्थल (operator site) को निष्क्रिय करने के लिए दमनकर को सक्रिय करता है।

प्रश्न 11.
निम्न के कार्यों का वर्णन (एक अथवा दो पंक्तियों में) कीजिए –

  1. उन्नायक (प्रोमोटर)
  2. अन्तरण आर०एन०ए० (t-RNA)
  3. एक्जॉन (Exons)

उत्तर

  1. प्रोमोटर – DNA का यह अनुक्रम जीन अनुलेखन इकाई बनाता है तथा अनुलेखन इकाई में स्थित टेम्पलेट व कूटलेखन रज्जुक का निर्धारण करता है।
  2. tRNA – tRNA प्रोटीन संश्लेषण के दौरान अमीनो अम्लों को कोशिकाद्रव्य से राइबोसोम तक स्थानान्तरित करता है।
  3. एक्जॉन (Exon) – एक्जॉन में नाइट्रोजनी क्षारकों का अनुक्रम होता है तथा ये mRNA के संश्लेषण में सहायता करते हैं।

प्रश्न 12.
मानव जीनोम परियोजना को महापरियोजना क्यों कहा जाता है?
उत्तर
मानव जीनोम परियोजना एक अत्यन्त व्यापक स्तर की योजना है जिसके अन्तर्गत मनुष्य के जीनोम में उपस्थित समस्त जीनों की पहचान की जाती है। मानव जीनोम में 3 x 109 क्षार युग्म हैं तथा प्रति क्षार पहचानने के लिए तीन अमेरिकी डॉलर का खर्च आता है। इस प्रकार संपूर्ण योजना पर लगभग 9 मिलियन डॉलर का खर्च आएगा। ज्ञात अनुक्रमों का संग्रह करने के लिए 1000 पृष्ठों की लगभग 3300 पुस्तकों की आवश्यकता होगी, यदि प्रत्येक पृष्ठ पर 10000 शब्द लिखे जायें। इस योजना को पूरी होने में 13 वर्ष का समय अनुमानित किया गया है।

अनेक देशों के हजारों वैज्ञानिक एक साथ इस पर कार्य करते हैं तो इसकी प्रथम प्रक्रिया पूर्ण होने में 10 वर्ष का समय लगता है। इतने स्तर के आँकड़ों के संग्रह, समापन व विश्लेषण के लिए उच्च कोटि के सांख्यिकीय साधनों की आवश्यकता होगी। अतः अपने इस वृहद् स्तर के कारण यह योजना, महापरियोजना कहलाती है।

प्रश्न 13.
डी०एन०ए० अंगुलिछापी क्या है? इसकी उपयोगिता पर प्रकाश डालिए। (2014, 15, 16, 17, 18)
उत्तर
डी०एन०ए० अंगुलिछापी
डी०एन०ए० फिंगर प्रिन्टिंग तकनीक (अंगुलिछापी) को सर्वप्रथम एलेक जेफ्रे (Alec Jaffreys) ने इंग्लैण्ड में विकसित किया था। इसकी सहायता से विभिन्न व्यक्तियों अथवा जीवधारियों के मूल आनुवंशिक पदार्थ (D.N.A.) में भिन्नताओं को देखा जा सकता है। जैसा कि ज्ञात है कि जीवधारी की प्रजाति के सभी सदस्यों के डी०एन०ए० प्रारूप भिन्न होते हैं। यही कारण है कि समरूपी जुड़वाँ (identical twins) को छोड़कर किसी भी व्यक्ति का फिंगर प्रिन्ट एक-दूसरे से मेल नहीं करता। प्रत्येक जीवधारी की सभी कोशिकाओं में एक जैसा डी०एन०ए० पाया जाता है। डी०एन०ए० के कारण एक व्यक्ति दूसरे व्यक्ति से भिन्न होता है। डी०एन०ए० के फिंगर प्रिन्टिग द्वारा डी०एन०ए० में स्थित उन क्षेत्रों की पहचान की जाती है जो एक व्यक्ति से दूसरे व्यक्ति में किसी भी मात्रा में भिन्नता दर्शाते हैं।

डी०एन०ए० के इन्हीं क्षेत्रों के कारण शरीर में विभिन्नताएँ उत्पन्न होती हैं। इन विभिन्नता दर्शाने वाले सैटेलाइट डी०एन०ए० (Satellite D.N.A.) को प्रोब (परीक्षण करने वाली सलाई) की भाँति प्रयोग करते हैं। इसमें काफी बहुरूपता होती है। एक्स-रे फिल्म पर एक पट्टिकाओं (bands) के क्रम के रूप में प्राप्त करके उनकी स्थिति, विशिष्टता और पहचान कर सकते हैं। किसी एक व्यक्ति के डी०एन०ए० के क्रम पट्टियों के रूप में अनिवार्य रूप से विशिष्ट होते हैं। समरूप जुड़वाँ के डी०एन०ए० पूर्णरूपेण समरूप हो सकते हैं।
UP Board Solutions for Class 12 Biology Chapter 6 Molecular Basis of Inheritance Q.13

इन पट्टियों का परिचित्र इलेक्ट्रोफोरेसिस तथा एक रेडियोऐक्टिव पदार्थ की सहायता से प्राप्त किया जाती है। विद्युत क्षेत्र की उपस्थिति में क्षारों की मात्रा विलोमानुपाती ढंग से दूरियाँ तय करती है जो कि बैण्ड्स या पट्टिकाओं के रूप में दृष्टिगोचर होती है।

डी०एन०ए० फिंगर प्रिन्ट विभिन्न ऊतकों (खून, बाल पुटक, त्वचा, अस्थि, लार, शुक्राणु आदि) से प्राप्त किए जा सकते हैं। डी०एन०ए० फिंगर प्रिन्ट का उपयोग अपराध मामलों जैसे-खूनी, बलात्कारी को पहचानने के लिए, पितृत्व के झगड़ों में पारिवारिक सम्बन्धों को ज्ञात करने आदि में किया जाता है।

प्रश्न 14.
निम्न का संक्षिप्त वर्णन कीजिए

  1. अनुलेखन, (2015)
  2. बहुरूपता,
  3. स्थानांतरण,
  4. जैव सूचना विज्ञान

उत्तर
1. अनुलेखन (Transcription) – DNA के रज्जुक में कूट के रूप में निहित आनुवंशिक सूचनाओं का mRNA में प्रतिलिपिकरण, अनुलेखन कहलाता है। इस प्रक्रिया के लिए RNA पॉलीमरेज नामक एंजाइम सहायक होता है। सर्वप्रथम DNA के न्यूक्लिओटाइड्स बनते हैं। तत्पश्चात् DNA रज्जुक अलग होकर साँचे के समान कार्य करने लगते हैं जिसके अनुसार नयी श्रृंखला में क्षारक क्रम व्यवस्थित होते हैं व H-बंधों द्वारा आपस में जुड़ जाते हैं।

2. बहुरूपता (Polymorphism) – जीन जनसंख्या में आनुवंशिक उत्परिवर्तनों का, उच्च आवृत्ति में होना, बहुरूपता कहलाता है। ऐसे उत्परिवर्तन DNA अनुक्रमों के परिवर्तित होने के कारण उत्पन्न होते हैं तथा पीढ़ी-दर-पीढ़ी वंशागत होकर एकत्रित होते हैं तथा बहुरूपता का कारण बनते हैं। बहुरूपता अनेक प्रकार की होती है तथा इसमें एक ही न्यूक्लिओटाइड में अथवा वृहद स्तर पर परिवर्तन होते हैं।

3. स्थानान्तरण (Translation) – mRNA न्यूक्लिओटाइड की श्रृंखलाओं का अमीनो अम्ल की | पॉलीपेप्टाइड शृंखलाओं में परिवर्तित होना, स्थानान्तरण कहलाता है। यह प्रक्रिया राइबोसोम पर, प्रोटीन संश्लेषण के दौरान होती है। इसमें सर्वप्रथम एंजाइम व ATP द्वारा अमीनो अम्ल का सक्रियकरण होता है। सक्रिय अमीनो अम्ल tRNA पर स्थानांतरित होते हैं वे संश्लेषण प्रारंभ हो जाता है। तत्पश्चात् पॉलीपेप्टाइड अनुक्रम निर्धारित होते हैं। tRNA अणुओं के मध्य उपस्थित पेप्टाइड स्थल द्वारा पेप्टाइड बंध निर्मित होते हैं।

4. जैव सूचना विज्ञान (Bioinformatics) – जीव विज्ञान का वह क्षेत्र जिसके अंतर्गत जीवों के जीनोम संबंधी आँकड़ों का संग्रह, विश्लेषण किया जाता है, जैव सूचना विज्ञान कहलाता है। इसमें मानव जीनोम के मानचित्र बनाये जाते हैं वे DNA के अनुक्रमों को पंक्तिबद्ध किया जाता है। इसका उपयोग कृषि सुधार, ऊर्जा उत्पादन, पर्यावरण सुधार, स्वास्थ्य सुरक्षा आदि में किया जाता है।

परीक्षोपयोगी प्रश्नोत्तर

बहुविकल्पीय प्रश्न
प्रश्न 1.
फॉस्फोडाइएस्टर बन्ध उपस्थित है – (2017)
(क) एडीपी में ।
(ख) एटीपी में
(ग) सी०एएमपी में
(घ) इनमें से किसी में नहीं
उत्तर
(घ) इनमें से किसी में नहीं

प्रश्न 2.
हरगोविन्द खुराना जाने जाते हैं – (2015, 17)
(क) प्रोटीन संश्लेषण के लिए
(ख) RNA संरचना की खोज के लिए
(ग) DNA संरचना की खोज के लिए
(घ) DNA लाइगेज एन्जाइम की खोज के लिए
उत्तर
(क) प्रोटीन संश्लेषण के लिए

प्रश्न 3.
डी०एन०ए० और आर०एन०ए० में समानता है – (2017)
(क) दोनों न्यूक्लियोटाइड्स की पॉलीमर श्रृंखला है।
(ख) दोनों में एक समान शर्करा पायी जाती है।
(ग) दोनों एक समान पाइरीमिडाइन्स से युक्त होते हैं।
(घ) दोनों इकहरी पॉलीन्यूक्लियोटाइड श्रृंखलाओं के रूप में होते हैं।
उत्तर
(क) दोनों न्यूक्लियोटाइड्स की पॉलीमर श्रृंखला है।

प्रश्न 4.
संदेशवाहक आर०एन०ए० का निर्माण होता है – (2017)
(क) केन्द्रक में
(ख) राइबोसोम में
(ग) गॉल्जीकाय में
(घ) एण्डोप्लाज्मिक रेटीकुलम में
उत्तर
(क) केन्द्रक में

अतिलघु उत्तरीय प्रश्न

प्रश्न 1.
आनुवंशिकता के गुणसूत्रीय सिद्धान्त को किसने प्रतिपादित किया? (2009)
उत्तर
सट्टन तथा बोवेरी (Sutton & Boveri, 1902) ने।

प्रश्न 2.
जीन की परिभाषा दीजिए। ये कहाँ पाये जाते हैं? (2014)
उत्तर
एक जीव के किसी भी लक्षण को निर्धारित करने वाले मेंडेलियन कारक को जीन कहते हैं। ये आनुवंशिक पदार्थ की एक प्रकार्यक इकाई होती है। जीन गुणसूत्र पर उपस्थित होते हैं।

प्रश्न 3.
अपनी उत्तर-पुस्तिका में लिखकर रिक्त स्थान की पूर्ति कीजिए। (2014)
डी०एन०ए० →…… → प्रोटीन्स” अणुजैविकी का केन्द्रीय सिद्धान्त है।
उत्तर
“डी०एन०ए० → आर०एन०ए० → प्रोटीन्स” अणुजैविकी का केन्द्रीय सिद्धान्त है।

प्रश्न 4.
न्यूक्लियोसाइड्स तथा न्यूक्लियोटाइड्स में अन्तर बताइए। (2010, 14)
उत्तर

  1. एक न्यूक्लियोटाइड न्यूक्लिक अम्ल की एक पूर्ण इकाई है, जबकि न्यूक्लियोसाइड में एक फॉस्फेट मूलक (PO4) की कमी होती है।
  2. स्वभाव में न्यूक्लियोसाइड्स क्षारकीय होते हैं जबकि न्यूक्लियोटाइड्स अम्लीय होते हैं।

प्रश्न 5.
न्यूक्लिओटाइड्स में पायी जाने वाली दो शर्कराओं के नाम सूत्र सहित लिखिए। (2010, 11)
उत्तर

  1. राइबोज शर्करा – C5H10O5 तथा
  2. डीऑक्सीराइबोज शर्करा – C5H10O4

प्रश्न 6.
न्यूक्लिओटाइड्स में पाये जाने वाले प्यूरीन के नाम लिखिए।
उत्तर
एडीनीन (adenine) तथा ग्वानीन (guanine)।

प्रश्न 7.
आर०एन०ए० तथा डी०एन०ए० का पूरा नाम लिखिए। (2015)
उत्तर
आर०एन०ए० = राइबो न्यूक्लिक ऐसिड
डी०एन०ए० = डीऑक्सीराइबो न्यूक्लिक एसिड

प्रश्न 8.
प्रोकैरियोटिक तथा यूकैरियोटिक डी०एन०ए० में अन्तर बताइए। (2012)
उत्तर
प्रोकैरियोटिक DNA के साथ प्रोटीन जुड़े नहीं रहते जबकि यूकैरियोटिक DNA के साथ हिस्टोन प्रोटीन जुड़े रहते हैं।

प्रश्न 9.
यूकैरियोटिक कोशिकाओं में कौन-से दो प्रकार के डी०एन०ए० पाये जाते हैं?
उत्तर
B – DNA तथा Z – DNA

प्रश्न 10.
Z – DNA क्या है? इसके प्रत्येक कुण्डल में कितने न्यूक्लिओटाइड्स होते हैं?
उत्तर
उच्च लवणता की स्थिति में B – DNA परिवर्तित होकर Z – DNA बनाता है। इसमें कुण्डलन वामावर्त होता है। कुण्डल का व्यास 18 Å तथा प्रत्येक कुण्डल में 12 जोड़ी न्यूक्लिओटाइड्स होते हैं।

प्रश्न 11.
डी०एन०ए० अणु का द्विकुण्डलित मॉडल किसने और कब प्रतिपादित किया? (2011)
उत्तर
डी०एन०ए० अणु का द्विकुण्डलित मॉडल 1953 ई० में वाटसन, क्रिक, विलकिन्स व फैंकलिन (J.D. Watson, F.H.C. Crick, M.H.F. Wilkins and R. Franklin) नामक वैज्ञानिकों ने प्रतिपादित किया। इनके इस कार्य के लिए इन्हें सन् 1962 में नोबेल पुरस्कार प्रदान किया गया।

प्रश्न 12.
पारक्रमण (transduction) क्या है? (2014)
उत्तर
पारक्रमण वह प्रक्रिया है जिसके अन्तर्गत वायरस (विषाणु) के द्वारा DNA का स्थानान्तरण एक जीवाणु से दूसरे जीवाणु में किया जाता है।

लघु उत्तरीय प्रश्न

प्रश्न 1.
डीऑक्सीराइबोज शर्करा क्या है? इस शर्करा की अणु संरचना बनाइए। (2012, 14)
उत्तर
डीऑक्सीराइबोज शर्करा (deoxyribose sugar) DNA में पाई जाती है। यह पाँच कार्बन युक्त (5C) होती है। इसका पाँचवाँ कार्बन परमाणु वलय से बाहर होता है। शर्करा का पहला कार्बन परमाणु हमेशा नाइट्रोजन क्षारक के साथ ग्लाइकोसिडिक बन्ध (glycosidic bond) द्वारा जुड़ा रहता है जबकि तीसरा तथा पाँचवाँ कार्बन परमाणु हमेशा फॉस्फेट अणु के साथ जुड़ता है। दो शर्करा अणु एक-दूसरे के साथ तीसरे कार्बन (3C) तथा पाँचवें कार्बन (5C) के साथ एक फॉस्फेट अणु फॉस्फोडाइएस्टर बन्ध (phosphodiester bond) द्वारा जुड़े रहते हैं।
UP Board Solutions for Class 12 Biology Chapter 6 Molecular Basis of Inheritance 2Q.1

प्रश्न 2.
DNA अणु की संरचना में चारगैफ के नियमों की महत्ता को स्पष्ट कीजिए। (2012)
उत्तर
चारगैफ (Chargaff) ने विभिन्न जीवों के DNA का अध्ययन किया और बताया कि

  1. सभी DNA अणुओं में प्यूरीन क्षारक की मात्रा पिरीमिडीन क्षारक के बराबर होती है। अतः
    \frac { adenine+guanine }{ purine } =\frac { thymine+cytosine }{ pyrimidine }
  2. भिन्न-भिन्न जातियों के जीवों के DNA में एडीनीन + थाइमीन तथा ग्वानीन + साइटोसीन का अनुपात
    (A + T : G + C) भिन्न-भिन्न होता है परन्तु एक ही जातियों के जीवों में यह समान होता है।
  3. एक ही जीव-जाति के सदस्यों में पाये जाने वाले DNA के कुल अणुओं में क्षारकों की संख्या समान होती है।

उपर्युक्त विचारों को “चारगैफ नियम” (Chargaff’s rule) के रूप में जाना जाता है।
वाटसन एवं क्रिक (Watson and Crick) ने भी DNA का मॉडल प्रस्तुत करने के लिये चारगैफ के नियमों की सहायता ली।

प्रश्न 3.
डी०एन०ए० तथा आर०एन०ए० में अन्तर लिखिए। (2009, 10, 11, 12, 13, 14, 16, 17)
उत्तर
डी०एन०ए० तथा आर०एन०ए० में अन्तर
UP Board Solutions for Class 12 Biology Chapter 6 Molecular Basis of Inheritance 2Q.3

प्रश्न 4.
RNA कितने प्रकार के होते हैं? इनके कार्य बताइए। (2013, 16)
या
राइबोसोमल आर०एन०ए० पर टिप्पणी लिखिए। (2010)
या
प्रोटीन संश्लेषण में भाग लेने वाले विभिन्न प्रकार के RNA अणुओं का वर्णन कीजिए। (2012)
या
विभिन्न प्रकार के आर०एन०ए० का नाम लिखिए। (2014)
उत्तर
आर०एन०ए० के प्रकार
RNA अधिक अणुभार वाली पॉलीन्यूक्लियोटाइड से मिलकर बना है। यह DNA से भिन्न होता है, क्योंकि इसमें डी-ऑक्सीराइबोज शर्करा के स्थान पर राइबोज शर्करा होती है और नाइट्रोजन बेस थाइमीन के स्थान पर यूरेसिल होता है। प्रत्येक कोशिका में RNA निम्नलिखित तीन प्रकार के होते हैं –

1. सन्देशवाहक आर0एन0ए0 (mRNA) – इनका निर्माण केन्द्रक में उपस्थित DNA पर ट्रांसक्रिप्शन की क्रिया द्वारा होता है। ये कोशिका की कुल RNA का 3 – 5% होते हैं और इनका आणविक-भार 500,000 से 2,000,000 होता है। केन्द्रक में DNA साँचे पर इनका निर्माण होता है। सन् 1961 में फ्रैंसिस जैकब (Francis Jacob) तथा जैक्यू मोनाड (Jacques Monod) ने इन्हें सन्देशवाहक RNA अणुओं का नाम दिया।
कार्य – सन्देशवाहक RNA अणु केन्द्रक से बाहर कोशिकाद्रव्य में आ जाता है। यहाँ यह केन्द्रक से आदेश लेकर राइबोसोम पर विभिन्न प्रकार के प्रोटीन बनाता है।

2. राइबोसोमल आर0एन0ए0 (rRNA) – ये RNA के संरचनात्मक (structural) अणु होते हैं। यह कोशिका की कुल RNA का 80% होता है। rRNA केन्द्रक में DNA से उत्पन्न होता है। तीनों प्रकार के RNA में यह सर्वाधिक समय तक क्रियाशील रहता है। प्रत्येक राइबोसोम का लगभग 65% भाग rRNA का तथा शेष 35% भाग प्रोटीन का होता है।
कार्य – rRNA राइबोसोम्स की रचना में भाग लेते हैं। यह प्रोटीन संश्लेषण में सहायता करता है।

3. स्थानान्तरण आर0एन0ए0 (tRNA or sRNA) – यह कोशिका की कुल आर०एन०ए० का 15-18% होता है। यह कोशिकाद्रव्य में पाया जाता है। ये सबसे छोटे व घुलनशील अणु होते हैं; अतः इन्हें विलेय RNA अणु (soluble RNA molecules) भी कहते हैं। इनको निर्माण केन्द्रक में DNA के साँचे (DNA template) पर होता है।
कार्य – ये विभिन्न प्रकार के अमीनो अम्लों को राइबोसोम्स पर लाते हैं, जहाँ प्रोटीन का संश्लेषण होता है।

प्रश्न 5.
आनुवंशिक कूट या जेनेटिक कोड्स क्या हैं? आनुवंशिक कोड में पाये जाने वाले एक समारम्भ व एक समापन कोडॉन को स्पष्ट कीजिए। (2009, 10, 12, 16)
या
आनुवंशिक कूट क्या है? इसकी कोई चार विशेषताएँ लिखिए। (2015, 17)
या
समारंभन कोडॉन एवं समापन कोडॉन से आप क्या समझते हैं? (2017)
उत्तर
आनुवंशिक कूट या जेनेटिक कोड
डी०एन०ए० (DNA) आनुवंशिक सूचनाओं या सन्देशों के टेप की भाँति है जिसमें नाइट्रोजन क्षारकों के अनुक्रमांक के रूप में आनुवंशिक सन्देश होते हैं। प्रोटीन में प्रायः विभिन्न प्रकार के 20 अमीनो अम्ल होते हैं परन्तु न्यूक्लिक अम्ल में केवल चार ही क्षारक होते हैं। इसे इस प्रकार भी कह सकते हैं कि प्रोटीन भाषा की वर्णमाला में 20 अमीनो अम्ल रूपी अक्षर (alphabets) होते हैं। इसी प्रकार न्यूक्लिक अम्लों की भाषा की वर्णमाला में चार क्षारक रूपी अक्षर होते हैं क्योंकि आनुवंशिक सूचना m-RNA से होकर प्रोटीन तक पहुँचती है, अतः RNA की भाषा का प्रोटीन की भाषा में अनुवाद करने के लिए एक शब्दकोष को तैयार करना आनुवंशिक कूट (genetic code) की समस्या थी।

एक चार अक्षरों की भाषा और दूसरी 20 अक्षरों की भाषा होने के कारण यह सम्भव नहीं है कि RNA भाषा का एक अक्षर अर्थात् एक क्षारक प्रोटीन भाषा के एक अक्षर अथवा एक अमीनो अम्ल के समतुल्य हो सके। इस प्रकार आनुवंशिक संकेत पद्धति में कुल 43 =4 x 4 x 4 = 64 कोडॉन होते हैं।

इस सम्बन्ध में अनेक सिद्धान्त प्रस्तुत किये गये परन्तु क्रिक (EH.C. Crick) द्वारा प्रस्तुत सिद्धान्त ही सर्वाधिक मान्य है। इस सिद्धान्त के अनुसार प्रत्येक अमीनो अम्ल के लिए तीन नाइट्रोजन क्षारकों का एक अनुक्रम या त्रिक् कोड (triplet code) होता है; अतः आनुवंशिक कूट या जेनेटिक कोड डी०एन०ए० अणुओं में स्थित नाइट्रोजन क्षारकों का वह अनुक्रम है जिसमें प्रोटीन अणुओं के संश्लेषण के लिए सन्देश निहित रहते हैं।

कोडॉन (Codon) – न्यूक्लियोटाइड्स के उस समूह को जिसमें किसी एक अमीनो अम्ल के लिए सन्देश या कोड हो, कोडॉन (codon) कहते हैं; जैसे-AUG समारम्भ कोडॉन है।
एण्टीकोडॉन (Anticodon) – t-RNA में उपस्थित उस तीन क्षारक समूह को जो m-RNA में उपस्थित कोडॉन का पूरक हो, एण्टीकोडॉन (anticodon) कहते हैं।

त्रिक कोड (Triplet code) – गैमो (Gamow, 1954) ने तीन अक्षरीय कोड की सम्भावना प्रकट की। DNA व RNA में कुल चार न्यूक्लियोटाइड्स होते हैं और लगभग 20 अमीनो अम्लों के विन्यास का कोड (code) इनके विन्यास पर आधारित होता है। अगर यह मान लिया जाये कि प्रत्येक कोड केवल एक न्यूक्लिओटाइड का बना होता है तो इससे कुल चार कोड बनेंगे जो केवल 4 अमीनो अम्लों के विन्यास को नियन्त्रित कर सकते हैं। अगर प्रत्येक कोड को दो न्यूक्लियोटाइड्स का बना हुआ माना जाये तो (4 x 4) केवल 16 कोड्स बनेंगे। ये भी 20 अमीनो अम्लों के लिए पर्याप्त नहीं हैं। तीन न्यूक्लियोटाइड्स के बने कोड से (4 x 4 x 4 = 64) 64 कोड शब्द बनते हैं। ये बीस अमीनो अम्लों के लिए आवश्यकता से अधिक हो जाते हैं; अतः गैमो की तीन अक्षरीय कोड की सम्भावना सही है।

श्रृंखला का समारम्भ एवं समापन करने वाले कोडॉन
सिस्ट्रोन के प्रथम कोडॉन को समारम्भ कोडॉन (initiation codon) कहते हैं। यह पॉलीपेप्टाइड श्रृंखला के कोडित होने के सन्देश को प्रारम्भ करता है। अधिकतर श्रृंखलाओं में AUG समारम्भ कोडॉन होता है। यह मेथिओनिन (methionine) नामक अमीनो अम्ल को कोडित करता है। इसी प्रकार सिस्ट्रोन का अन्तिम कोडॉन पॉलीपेप्टाइड श्रृंखला का समापन करता है। इसे समापन कोडॉन (termination codon) कहते हैं। समापन कोडॉन तीन होते हैं-UAA, UGA तथा UAG। प्रारम्भ में जब इनके कार्य का ज्ञान नहीं था तो ये निरर्थक कोडॉन (nonsense codon) कहलाते थे।

विस्तृत उत्तरीय प्रश्न

प्रश्न 1.
डी०एन०ए० की आणविक संरचना का सचित्र वर्णन कीजिए तथा डी०एन०ए० के द्विगुणन में इसका महत्त्व समझाइए। (2009,12)
या
डी०एन०ए० की संरचना के वाटसन एवं क्रिक मॉडल को उपयुक्त चित्र बनाकर समझाइए। (2014, 16)
या
न्यूक्लिक अम्ल की परिभाषा लिखिए। वाटसन एवं क्रिक द्वारा प्रतिपादित डी०एन०ए० मॉडल की संरचना का वर्णन कीजिए। (2014)
या
वाटसन एवं क्रिक द्वारा प्रस्तुत डी०एन०ए० की रासायनिक संरचना का वर्णन कीजिए तथा इसकी आनुवंशिक पदार्थ के रूप में मान्यता का उल्लेख कीजिए। (2015, 17)
उत्तर
न्यूक्लिक अम्ल
सर्वप्रथम आल्टमान (1889) ने केन्द्रकीय पदार्थ को निकालकर इसमें से प्रोटीन्स को पृथक् किया तथा शेष फॉस्फोरस युक्त पदार्थ को अम्लीय होने के कारण न्यूक्लिक अम्ल कहा। ये दो प्रकार के होते हैं-DNA व RNA

डीऑक्सीराइबो न्यूक्लिक अम्ल (DNA) तथा इसकी संरचना
एक डी०एन०ए० (डीऑक्सीराइबो न्यूक्लिक अम्ल) अणु एक बहुलक (polymer) है जो आनुवंशिक लक्षणों को एक पीढ़ी से दूसरी पीढ़ी में स्थानान्तरित करता है; अतः इसे आनुवंशिक अणु (molecule of heredity) भी कहते हैं। डी०एन०ए० (DNA = deoxyribo nucleic acid) की खोज फ्रीडरिक मीशर (Friedrich Miescher, 1869) ने की थी। सबसे पहले विलकिन्स तथा फ्रैंकलिन (Wilkins and Franklin, 1952) ने बताया कि डी०एन०ए० एक कुण्डलित (helical) संरचना होती है। 1953 ई० में वाटसन तथा क्रिक (Watson and Crick) ने डी०एन०ए० संरचना का द्विकुण्डलित मॉडल (Double Helix Model) प्रस्तुत किया।

यह दो लम्बी श्रृंखलाओं के बने दो। कुण्डल (helices) होते हैं जो आधारभूत रूप में विशेष इकाइयों जिन्हें न्यूक्लियोटाइड्स (nucleotides) कहा जाता है, से बने होते हैं। इस प्रकार, एक अणु में सहस्रों से लेकर लाखों तक न्यूक्लियोटाइड्स होते हैं अर्थात् ये श्रृंखलाएँ पॉलीन्यूक्लियोटाइड (polynucleotide) श्रृंखलाएँ होती हैं। इस प्रकार, डी०एन०ए० की संरचना अनेक बहुलकों (polymers) की श्रृंखलाओं (chains) के दोहरे होने से बनती है। ये श्रृंखलाएँ काफी लम्बी तथा अणु अत्यधिक बड़े होते हैं। प्रत्येक श्रृंखला का प्रत्येक न्यूक्लियोटाइड एक विशिष्ट तथा जटिल संरचना है। यह स्वयं तीन प्रकार के अणुओं या मूलकों (radicals) से मिलकर बना होता है, जिनमें

  1. एक पेन्टोज शर्करा (pentose sugar), डीऑक्सीराइबोज (deoxyribose) प्रकार की अर्थात् | यह एक पाँच कार्बन वाली शर्करा होती है।
    2. एक फॉस्फेट (phosphate) मूलक जो एक अणु फॉस्फोरिक अम्ल (phosphoric acid = H3PO4) से बनता है।
    3. एक नाइट्रोजन क्षारक (nitrogen base) जो दो प्रकार के तथा कुल चार क्षारकों में से एक होता है। ये इस प्रकार हैं –
    (क) प्यूरीन (purine) प्रकार के जिनमें 2-N रिंग होती है; ये हैं – एडीनीन (adenine) व ग्वानीन (guanine) तथा
    UP Board Solutions for Class 12 Biology Chapter 6 Molecular Basis of Inheritance 3Q.1.1
  2. UP Board Solutions for Class 12 Biology Chapter 6 Molecular Basis of Inheritance 3Q.1.2

(ख) पिरामिडीन (pyrimidine) प्रकार के जिनमें नाइट्रोजन की एकल रिंग होती है; उदाहरण हैं – साइटोसीन (cytosine) तथा थाइमीन (thymine) क्षारक।

DNA के एक अणु में डीऑक्सीराइबोज शर्करा (deoxyribose sugar) का एक अणु क्षारक (base) के एक अणु से जुड़ा रहता है। इस यौगिक को डीऑक्सीराइबोसाइड (deoxyriboside) कहते हैं। यह एक न्यूक्लिओसाइड (nucleoside) है। अब यह न्यूक्लिओसाइड एक फॉस्फोरिक अम्ल (HI PO4) से मिलकर डीऑक्सीराइबो न्यूक्लिओटाइड (deoxyribo nucleotide) बनाता है। न्यूक्लिओटाइड के एक अणु में क्षारक का अणु सदैव शर्करा के अणु से जुड़ता है। इसी तरह फॉस्फोरिक अम्ल का एक अणु भी शर्करा के एक अणु से जुड़ा रहता है।

चार विभिन्न नाइट्रोजन बेस होने के कारण डी०एन०ए० (DNA) के अणु में चार प्रकार के न्यूक्लिओसाइड व चार न्यूक्लिओटाइड होते हैं। एक डी०एन०ए० अणु में दो लम्बी श्रृंखलाएँ होती हैं जिनमें क्षारक (base) का अणु अक्ष (axis) की ओर होता है। दोनों श्रृंखलाओं के क्षारकों के अणु एक-दूसरे से हाइड्रोजन बन्ध (H-bonds) से जुड़कर क्षारक का एक जोड़ा बना लेते हैं। इन हाइड्रोजन बन्धों के मध्य 2.83 – 2.90 A का स्थान होता है। इन बन्धों से न्यूक्लिओटाइड्स की दो श्रृंखलाएँ बँधी होती हैं।

ये दोनों शृंखलाएँ एक-दूसरे की परिपूरक (complementary) होती हैं। ये दोनों श्रृंखलाएँ एक-दूसरे से उल्टी दिशा में (antiparallel) होती हैं अर्थात् एक श्रृंखला में फॉस्फोडाइएस्टर लिंकेज (phosphodiester linkage) 3’→ 5′ एक दिशा में तथा दूसरी श्रृंखला में 5’→ 3′ उल्टी दिशा में होते हैं। इस प्रकार डी०एन०ए० एक सीढ़ी की तरह लगता है। DNA का व्यास (diameter) 20 Å होता है।

डी०एन०ए० का द्विकुण्डल प्रतिरूप
सन् 1953 में वाटसन, क्रिक, विलकिन्स व फ्रैंकलिन (J.D. Watson, EH.C. Crick, M.H.E Wilkins and R. Franklin) नामक वैज्ञानिकों ने एक्स-रे विश्लेषण (X-ray diffraction studies) द्वारा डी०एन०ए० (DNA) का द्विकुण्डल प्रतिरूप (double helical model) प्रस्तुत किया जिस पर उन्हें सन् 1962 में नोबेल पुरस्कार मिला। इस मॉडल के अनुसार डी०एन०ए० (DNA) अणु पॉलीन्यूक्लियोटाइट्स के दो स्टैण्ड्स (strands) का बना होता है। दोनों स्टैण्ड्स एक ही केन्द्रीय अक्ष पर कुण्डलित रहते हैं और अक्ष के चारों ओर एक द्विचक्राकार (double helical) संरचना बना लेते हैं। प्रत्येक चक्राकार संरचना में न्यूक्लिओटाइड्स के 10 युगल (ten pairs) होते हैं और एक चक्र से दूसरे चक्र की दूरी 34 में होती है अर्थात् एक न्यूक्लिओटाइड का दूसरे न्यूक्लिओटाइड से अन्तर 3.4 Å होता है। Φ × 174 कॉलीफेज (coliphage) तथा 513 ई० कोलाई फेज (E. coti phase) नामक वाइरस (virus) में अपवाद स्वरूप डी०एन०ए० (DNA) में पॉली डीऑक्सीराइबोन्यूक्लिओटाइड की एक श्रृंखला (single strand) ही होती है।

प्रत्येक क्षारक युग्म में प्यूरीन प्रकार का क्षारक एडिनीन (adenine) हमेशा पिरीमिडीन प्रकार के क्षारक थाइमीन (thymine) से तथा ग्वानीन (guanine) प्रकार का प्यूरीन क्षारक हमेशा पिरीमिडीन प्रकार के साइटोसीन (cytosine) क्षारक के साथ ही जुड़कर पगदण्ड का एक भाग बनाता है। इसमें अन्य किसी भी प्रकार का युग्म सम्भव नहीं है। इस प्रकार, यदि एक श्रृंखला में T-C-G-A-T-C-G आदि हैं तो दूसरी श्रृंखला में T के सामने A, c के सामने G, G के सामने C तथा A के सामने T आदि ही होंगे। इस प्रकार
UP Board Solutions for Class 12 Biology Chapter 6 Molecular Basis of Inheritance 3Q.1.3

पगदण्ड में न्यूक्लियोटाइड के क्षारक हाइड्रोजन बन्धों (H-bonds) के द्वारा जुड़े होते हैं। इसमें एडिनीन, थाइमीन के साथ दो साइटोसीन, ग्वानीन के साथ तीन बन्धों से बन्धनयुक्त होता है। क्षारकों का निश्चित क्रम डी०एन०ए० की रासायनिक शब्दावली बनाता है जिससे आनुवंशिक लक्षणों की स्थापना होती है।
[संकेत–डी०एन०ए० की संरचना का महत्त्व विस्तृत उत्तरीय प्रश्न 2 के उत्तर में देखिए।]

प्रश्न 2.
डी०एन०ए० द्विगुणन (replication of DNA) के प्रमुख चरणों का उल्लेख कीजिए। DNA के महत्त्वपूर्ण कार्य क्या हैं?
या
डी०एन०ए० के द्विगुणन (प्रतिकृतियन) का संक्षिप्त वर्णन कीजिए। (2015, 16)
या
डी०एन०ए० की अर्धसंरक्षी द्विगुणन विधि का वर्णन कीजिए। (2017)
उत्तर
डी०एन०ए० का द्विगुणन
वाटसन एवं क्रिक (Watson and Crick) ने बताया कि डी०एन०ए० (DNA) एक द्विकुण्डलिनी संरचना है, जो दो पॉलीन्यूक्लियोटाइड श्रृंखलाओं से मिलकर बना है। ये श्रृंखलाएँ प्रतिसप्तान्तर (antiparallel) तथा एक-दूसरे की पूरक (complementary) होती हैं। डी०एन०ए० अणु का द्विगुणन अर्द्धसंरक्षी (semiconservative) होता है। इसका तात्पर्य यह है कि नये बने DNA अणु में एक सूत्र (strand) पैतृक होगा तथा दूसरा सूत्र नवनिर्मित होगा। सन् 1958 में मैथ्यू मेसेल्सन । (Matthew Meselson) तथा फ्रैंकलिन स्टाहल (Franklin Stahl) ने एश्केरीशिया कोलाई (Eischerichia coli = E. coli) नामक जीवाणु के डी०एन०ए० अणु पर ऐसे द्विगुणन की पुष्टि की। डी०एन०ए० के द्विगुणन को हम निम्नलिखित प्रमुख चरणों में बाँट सकते हैं –

1. डी0एन0ए0 अणुओं के पराकुण्डलों का अकुण्डलन एवं पुनर्कुण्डलन (Decoiling and Recoiling of Supercoils of DNA Molecules) – डी०एन०ए० अणुओं के पराकुण्डलन एवं अकुण्डलन का नियमन कुछ विशेष एन्जाइम करते हैं, जिन्हें टोपोआइसोमेरेज (topoisomerase) कहते हैं। द्विगुणन के लिए ये एन्जाइम धीरे-धीरे डी०एन०ए० अणु के छोटे-छोटे स्थानीय खण्डों में इसका पराकुण्डलन समाप्त करके द्विकुण्डलिनी (duplex) को खोलते रहते हैं और द्विगुणन के बाद सन्तति अणुओं का पुनर्कुण्डलन भी करते रहते हैं। ये दो प्रकार के होते हैं-टोपोआइसोमेरेज-1 (topoisomerase-I) तथा टोपोआइसोमेरेज-II (topoisomerase-II)।

टोपोआइसोमेरेज-I DNA की द्विकुण्डलिनी के एक सूत्र में कटाव (nick) पैदा करता है, जबकि टोपोआइसोमेरेज-II DNA द्विकुण्डलिनी के दोनों सूत्रों में कटाव उत्पन्न करता है। इसे डी०एन०ए० गाइरेज (DNA gyrase) भी कहते हैं। इन कटावों के बनने से ही स्थानीय अकुण्डलन से शेष द्विकुण्डलिनी में होने वाला घूर्णन (rotation) समाप्त । होता है।

2. द्विकुण्डलिनी का खुलना (Unwinding of Double Helix) – डी०एन०ए० अणु का द्विगुणन कुछ निर्दिष्ट स्थानों पर ही होता है, जिन्हें द्विगुणन मूल (replication origins) कहते हैं। यूकैरियोटिक कोशिकाओं में DNA अपेक्षाकृत लम्बे, रेखीय वे एक से लेकर कई युग्मों (pairs) में होते हैं। प्रत्येक अणु के द्विगुणन के लिए इसमें अनेक द्विगुणन मूल होते हैं। इन द्विगुणन मूल पर कुछ विशेष प्रकार की मूल-बन्धिनी प्रोटीन्स (origin-binding proteins) द्विकुण्डलिनी से जुड़ जाती हैं। यहीं पर विभिन्न प्रकार के प्रोटीन्स व एन्जाइम्स एकत्र होकर द्विगुणन में विविध भूमिकाएँ निभाते हैं।

ई० कोलाई (E. coli) में इन मूल-बन्धिनी प्रोटीन्स को ‘ori C’ का नाम दिया गया है। ये प्रोटीन्स ए०टी०पी० की सहायता से द्विगुणन मूलों के समाक्षारों के युग्मों से H-बन्धों (H-bonds) को हटा देती हैं। द्विगुणने मूल H-बन्धों (H-bonds) के टूटते ही दोहरा हैलिक्स खुल जाता है, इसे डी०एन०ए० अणु का द्रवण (melting) कहते हैं। दोनों कुण्डल के अलग होने से ‘Y’ आकार की चिमटी के समान द्विशाखी, द्विगुणन काँटे (replication fork) जैसी संरचना बन जाती है। प्रत्येक द्विशाख पर एक सूत्र से डी०एन०ए० हेलिकेज (DNA helicase) नामक एन्जाइम का एक बड़ा अणु लिपट जाता है। यह एन्जाइम डी०एन०ए० के सूत्रों को धीरे-धीरे खोलने अर्थात् द्रवण का कार्य करता है।

3. न्यूक्लियोटाइड्स का सक्रियकरण (Activation of Nucleotides) – न्यूक्लियोसाइड एन्जाइम फॉस्फोराइलेज (phosphorylase) तथा ए०टी०पी० की उपस्थिति में सक्रिय हो जाते हैं। इस प्रक्रिया को फॉस्फोरिलेशन कहते हैं।

4. आर0एन0ए0 प्रवेशक का निर्माण (Formation of RNA Prirmers) – द्विगुणन शाखाओं के बनते ही प्रत्येक द्विशाख पर अलग हुए प्रत्येक DNA सूत्र पर राइबोन्यूक्लियोटाइड (ribonucleotide) अणुओं की एक छोटी अनुपूरक (complementary) श्रृंखला (RNA का छोटा अणु) बन जाती है। इन RNA अणुओं को प्रवेशक (primer) कहते हैं, क्योंकि इन्हीं के 3′ छोरों पर डीऑक्सीराइबो न्यूक्लियोटाइड अणुओं को जोड़कर DNA की एक नयी श्रृंखला का संश्लेषण किया जाता है। आर०एन०ए० प्राइमर का संश्लेषण प्राइमेज (primase) एन्जाइम  या RNA पॉलीमेरेज (RNA polymerase) की सहायता से होता है।

5. डी0एन0ए0श्रृंखला का निर्माण तथा दीर्धीकरण (Formation and Elongation of DNA Chain) – एन्जाइम डी०एन०ए० पॉलीमेरेज-III (DNA polymerase-III) RNA प्राइमर में 5’→3′ दिशा में नये क्षारकों को जोड़ता है। इन क्षारकों का क्रम DNA टेम्पलेट के अनुसार होता है। डी०एन०ए० अणु के दो सूत्र प्रतिसमान्तर होते हैं अर्थात् एक की दिशा 5’→3′ तथा दूसरे की 3′ → 5′ होती है।

एन्जाइम डी०एन०ए० पॉलीमरेज III क्षारकों को केवल 5′ – 3′ दिशा में ही जोड़ सकता है; अत: 3′ – 5′ दिशा वाले DNA टेम्पलेट पर नई DNA श्रृंखला का सतत् निर्माण (continuous synthesis) होता है। ऐसे सूत्र को अगुआ सूत्र या अग्रक रज्जुक (leading strand) कहते हैं। इसके विपरीत जिस नई DNA श्रृंखला का निर्माण 3’→ 5′ दिशा में होता है अर्थात् 5’→3′ दिशा वाले पैतृक सूत्र पर यह असतत् होता है। इस प्रकार यह निर्माण छोटे-छोटे खण्डों के रूप में होता है, ये खण्ड ओकाजाकी खण्ड (Okajaki fragments) कहलाते हैं। इस प्रकार, खण्डों के रूप में हुए निर्माण के कारण इस नये सूत्र को पश्चगामी रज्जुक या पिछुआ सूत्र (lagging strand) कहते हैं। पिछुआ सूत्र के पृथक्-पृथक् टुकड़ों में बनने की प्रक्रिया की खोज रोजी ओकाजाकी (Reiji Okajaki 1968) ने की थी ।
UP Board Solutions for Class 12 Biology Chapter 6 Molecular Basis of Inheritance 3Q.2

6. आर0एन0ए0 प्रवेशक का हटना (Removal of RNA Primer) – DNA श्रृंखला की लम्बाई बढ़ने के बाद आर०एन०ए०प्रवेशक (RNA primer) श्रृंखला से हट जाता है। आर०एन०ए० प्रवेशक के हटने से उत्पन्न रिक्त स्थान को भरने में डी०एन०ए०पॉलीमेरेज-1 (DNA polymerase-I) सहायता करता है। जब DNA का निर्माण पूरा हो जाता है तो एन्जाइम DNA हेलिकेज की क्रिया रुक जाती है।

डी०एन०ए० का महत्त्व तथा कार्य
न्यूक्लिक अम्लों को जीवन को चलाये रखने का प्रमुख आधार माना जाता है। ये पीढ़ी-दर-पीढ़ी लक्षणों के प्रकटन से लेकर उन लक्षणों के अन्तर्गत विभिन्न क्रियाओं को उनके निर्दिष्ट तक उचित विधि द्वारा, उचित स्वरूप में तथा नियमित एवं नियन्त्रित अनुक्रियाओं के द्वारा, पहुँचाने का कार्य करते हैं। इस प्रकार –

  1. डीऑक्सीराइबो न्यूक्लिक अम्ल (DNA) आनुवंशिक सूचनाओं के वाहक का कार्य करता है। तथा सभी आनुवंशिक लक्षणों को पुरानी पीढ़ी से नई पीढ़ी में पहुँचाता है।
  2. DNA के द्वारा निर्मित राइबोन्यूक्लिक अम्ल (RNA) विभिन्न अमीनो अम्लों से DNA द्वारा निर्देशित प्रोटीन का संश्लेषण करते हैं जो विभिन्न प्रकार की क्रियाओं-अनुक्रियाओं को होने देने में एन्जाइम्स (enzymes) के रूप में सहायक होती हैं।
  3. DNA के भाग या उसके द्वारा निर्मित कुछ न्यूक्लियोटाइड हॉर्मोन्स (hormones), सह-एन्जाइमों (co-enzymes) आदि के रूप में कार्य करते हैं।
  4. जिस मास्टर योजना (master plan) के अन्तर्गत जन्म से मृत्यु तक किसी जीव में कोशिकाएँ बनती हैं और कार्य करती हैं, उसकी मूल रूपरेखा (original blue print) डी०एन०ए० के रूप में होती है।

Chapter 6 Molecular Basis of Inheritance (वंशागति का आणविक आधार)